Article (Scientific journals)
Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara; Pagano, Bruno; Borbone, Nicola et al.
2011In Bioconjugate Chemistry, 22, p. 654-663
Peer Reviewed verified by ORBi
 

Files


Full Text
2011-BioconjChem_Jussara_ckit.pdf
Publisher postprint (4.05 MB)
Request a copy

All documents in ORBi are protected by a user license.

Send to



Details



Keywords :
mass spectrometry; G-quadruplex; non-covalent; DNA; nucleic acids; PNA
Abstract :
[en] The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”.
Research Center/Unit :
Giga-Systems Biology and Chemical Biology - ULiège
Disciplines :
Chemistry
Biochemistry, biophysics & molecular biology
Author, co-author :
Amato, Jussara
Pagano, Bruno
Borbone, Nicola
Oliviero, Giorgia
Gabelica, Valérie ;  Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.)
De Pauw, Edwin  ;  Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.)
D'Errico, Stefano
Piccialli, Vincenzo
Varra, Michela
Giancola, Concetta
Piccialli, Gennaro
Mayol, Luciano
Language :
English
Title :
Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Publication date :
2011
Journal title :
Bioconjugate Chemistry
ISSN :
1043-1802
eISSN :
1520-4812
Publisher :
American Chemical Society (ACS), Washington, United States - District of Columbia
Volume :
22
Pages :
654-663
Peer reviewed :
Peer Reviewed verified by ORBi
Funders :
F.R.S.-FNRS - Fonds de la Recherche Scientifique
Available on ORBi :
since 04 July 2011

Statistics


Number of views
234 (6 by ULiège)
Number of downloads
1 (1 by ULiège)

Scopus citations®
 
45
Scopus citations®
without self-citations
28
OpenAlex citations
 
48

Bibliography


Similar publications



Contact ORBi