Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences

[en] The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1 P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as “quadruplex openers”.

Research Center/Unit :

Giga-Systems Biology and Chemical Biology - ULiège

Disciplines :

Chemistry
Biochemistry, biophysics & molecular biology

Author, co-author :

Amato, Jussara

Pagano, Bruno

Borbone, Nicola

Oliviero, Giorgia

Gabelica, Valérie ; Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.)

De Pauw, Edwin ; Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.)

D'Errico, Stefano

Piccialli, Vincenzo

Varra, Michela

Giancola, Concetta

Piccialli, Gennaro

Mayol, Luciano

Language :

English

Title :

Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences

Publication date :

2011

Journal title :

Bioconjugate Chemistry

ISSN :

1043-1802

eISSN :

1520-4812

Publisher :

American Chemical Society, Washington, United States - District of Columbia

Volume :

Pages :

654-663

Peer reviewed :

Peer Reviewed verified by ORBi

Funders :

F.R.S.-FNRS - Fonds de la Recherche Scientifique

Available on ORBi :

since 04 July 2011

Statistics

Number of views

154 (6 by ULiège)

Number of downloads

1 (1 by ULiège)

More statistics

Scopus citations^®

Scopus citations^®
without self-citations

OpenCitations

OpenAlex citations

Bibliography

Neidle, S. (2009) The structures of quadruplex nucleic acids and their drug complexes Curr. Opin. Struct. Biol. 19, 239-250
Huppert, J. L. and Balasubramanian, S. (2005) Prevalence of quadruplexes in the human genome Nucleic Acids Res. 33, 2908-2916 (Pubitemid 41511230)
Todd, A. K., Johnston, M., and Neidle, S. (2005) Highly prevalent putative quadruplex sequence motifs in human DNA Nucleic Acids Res. 33, 2901-2907 (Pubitemid 41511229)
Eddy, J. and Maizels, N. (2006) Gene function correlates with potential for G4 DNA formation in the human genome Nucleic Acids Res. 34, 3887-3896 (Pubitemid 44391004)
Shklover, J., Weisman-Shomer, P., Yafe, A., and Fry, M. (2010) Quadruplex structures of muscle gene promoter sequences enhance in vivo MyoD-dependent gene expression Nucleic Acids Res. 38, 2369-2377
Cogoi, S., Paramasivam, M., Membrino, A., Yokoyama, K. K., and Xodo, L. E. (2010) The KRAS promoter responds to Myc-associated zinc finger and poly(ADP-ribose) polymerase 1 proteins, which recognize a critical quadruplex-forming GA-element J. Biol. Chem. 285, 22003-22016
Palumbo, S. L., Memmott, R. M., Uribe, D. J., Krotova-Khan, Y., Hurley, L. H., and Ebbinghaus, S. W. (2008) A novel G-quadruplex-forming GGA repeat region in the c-myb promoter is a critical regulator of promoter activity Nucleic Acids Res. 36, 1755-1769 (Pubitemid 351494223)
Sun, D., Guo, K., Rusche, J. J., and Hurley, L. H. (2005) Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents Nucleic Acids Res. 33, 6070-6080 (Pubitemid 41742625)
Siddiqui-Jain, A., Grand, C. L., Bearss, D. J., and Hurley, L. H. (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription Proc. Natl. Acad. Sci. U.S.A. 99, 11593-11598 (Pubitemid 34994444)
Hurley, L. H., Von Hoff, D. D., Siddiqui-Jain, A., and Yang, D. (2006) Drug Targeting of the c-MYC promoter to repress gene expression via a G-quadruplex silencer element Semin. Oncol. 33, 498-512 (Pubitemid 44142743)
Rankin, S., Reszka, A. P., Huppert, J., Zloh, M., Parkinson, G. N., Todd, A. K., Ladame, S., Balasubramanian, S., and Neidle, S. (2005) Putative DNA quadruplex formation within the human c-kit oncogene J. Am. Chem. Soc. 127, 10584-10589 (Pubitemid 41061432)
Fernando, H., Reszka, A. P., Huppert, J., Ladame, S., Rankin, S., Venkitaraman, A. R., Neidle, S., and Balasubramanian, S. (2006) A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene Biochemistry 45, 7854-7860 (Pubitemid 44185502)
Sakurai, S., Fukasawa, T., Chong, J. M., Tanaka, A., and Fukayama, M. (1999) C-kit gene abnormalities in gastrointestinal stromal tumors (tumors of interstitial cells of Cajal) Jpn J. Cancer Res. 90, 1321-1328 (Pubitemid 30032070)
Looijenga, L. H., de Leeuw, H., van Oorschot, M., van Gurp, R. J., Stop, H., Gillis, A., de Gouveia Brazao, C. A., Weber, R. E., Kirkels, W. J., van Dijk, T., and von Lindern, M. (2003) Stem cell factor receptor (c-KIT) codon 816 mutations predict development of bilateral testicular germ-cell tumors Cancer Res. 63, 7674-7678 (Pubitemid 37466695)
Wang, Y. Y., Zhou, G. B., Yin, T., Chen, B., Shi, J. Y., Liang, W. X., Jin, X. L., You, J. H., Yang, G., Shen, Z. X., Chen, J., Xiong, S. M., Chen, G. Q., Xu, F., Liu, Y. W., Chen, Z., and Chen, S. J. (2005) AML1-ETO and C-KIT mutation/overexpression in t(8;21) leukemia: implication in stepwise leukemogenesis and response to Gleevec Proc. Natl. Acad. Sci. U.S.A. 102, 1104-1109 (Pubitemid 40170733)
Fletcher, J. A. and Rubin, B. P. (2007) KIT Mutations in GIST Curr. Opin. Genet. Dev. 17, 3-7 (Pubitemid 46109300)
Kumar, N., Patowary, A., Sivasubbu, S., Petersen, M., and Maiti, S. (2008) Silencing c-MYC expression by targeting quadruplex in P1 promoter using locked nucleic acid trap Biochemistry 47, 13179-13188
Ou, T. M., Lu, Y. J., Tan, J. H., Huang, Z. S., Wong, K. Y., and Gu, L. Q. (2008) G-quadruplexes: Targets in anticancer drug design ChemMedChem 3, 690-713
Pagano, B. and Giancola, C. (2007) Energetics of quadruplex-drug recognition in anticancer therapy Curr. Cancer Drug Targets 7, 520-540 (Pubitemid 47358140)
Gunaratnam, M., Swank, S., Haider, S. M., Galesa, K., Reszka, A. P., Beltran, M., Cuenca, F., Fletcher, J. A., and Neidle, S. (2009) Targeting human gastrointestinal stromal tumor cells with a quadruplex-binding small molecule J. Med. Chem. 52, 3774-3783
Bejugam, M., Sewitz, S., Shirude, P. S., Rodriguez, R., Shahid, R., and Balasubramanian, S. (2007) Trisubstituted isoalloxazines as a new class of G-quadruplex binding ligands: small molecule regulation of c-kit oncogene expression J. Am. Chem. Soc. 129, 12926-12927 (Pubitemid 350058320)
Phan, A. T., Kuryavyi, V., Burge, S., Neidle, S., and Patel, D. J. (2007) Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter J. Am. Chem. Soc. 129, 4386-4392 (Pubitemid 46595454)
Todd, A. K., Haider, S. M., Parkinson, G. N., and Neidle, S. (2007) Sequence occurrence and structural uniqueness of a G-quadruplex in the human c-kit promoter Nucleic Acids Res. 35, 5799-5808 (Pubitemid 47506295)
Nielsen, P. E., Egholm, M., Berg, R. H., and Buchardt, O. (1991) Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide Science 254, 1497-1500 (Pubitemid 21917487)
Nielsen, P. E. and Christensen, L. (1996) Strand displacement binding of a duplex-forming homopurine PNA to a homopyrimidine duplex DNA target J. Am. Chem. Soc. 118, 2287-2288 (Pubitemid 26106360)
Zhang, X., Ishihara, T., and Corey, D. R. (2000) Strand invasion by mixed base PNAs and a PNA-peptide chimera Nucleic Acids Res. 28, 3332-3338 (Pubitemid 30662298)
Roy, S., Tanious, F. A., Wilson, W. D., Ly, D. H., and Armitage, B. A. (2007) High-affinity homologous peptide nucleic acid probes for targeting a quadruplex-forming sequence from a MYC promoter element Biochemistry 46, 10433-10443 (Pubitemid 47417239)
Paul, A., Sengupta, P., Krishnan, Y., and Ladame, S. (2008) Combining G-quadruplex targeting motifs on a single peptide nucleic acid scaffold: a hybrid (3 + 1) PNA-DNA bimolecular quadruplex Chemistry 14, 8682-8689
Onyshchenko, M. I., Gaynutdinov, T. I., Englund, E. A., Appella, D. H., Neumann, R. D., and Panyutin, I. G. (2009) Stabilization of G-quadruplex in the BCL2 promoter region in double-stranded DNA by invading short PNAs Nucleic Acids Res. 37, 7570-7580
Kypr, J., Kejnovska, I., Renciuk, D., and Vorlickova, M. (2009) Circular dichroism and conformational polymorphism of DNA Nucleic Acids Res. 37, 1713-1725
Mergny, J. L., Phan, A. T., and Lacroix, L. (1998) Following G-quartet formation by UV-spectroscopy FEBS Lett. 435, 74-78 (Pubitemid 28432018)
Mergny, J. L., Li, J., Lacroix, L., Amrane, S., and Chaires, J. B. (2005) Thermal difference spectra: a specific signature for nucleic acid structures Nucleic Acids Res. 33, e138
Rosu, F., De Pauw, E., and Gabelica, V. (2008) Electrospray mass spectrometry to study drug-nucleic acids interactions Biochimie 90, 1074-1087
Pagano, B., Mattia, C. A., and Giancola, C. (2009) Applications of isothermal titration calorimetry in biophysical studies of G-quadruplexes Int. J. Mol. Sci. 10, 2935-2957
Matteucci, M. D. and Caruthers, M. H. (1981) Synthesis of deoxyoligonucleotides on a polymer support J. Am. Chem. Soc. 103, 3185-3191
Beaucage, S. L. and Caruthers, M. H. (1981) Deoxynucleoside phosphoramidites - A new class of key intermediates for deoxypolynucleotide synthesis Tetrahedron Lett. 22, 1859-1862
McBride, L. J. and Caruthers, M. H. (1983) An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides Tetrahedron Lett. 24, 245-248
Christensen, L., Fitzpatrick, R., Gildea, B., Petersen, K. H., Hansen, H. F., Koch, T., Egholm, M., Buchardt, O., Nielsen, P. E., Coull, J., and Berg, R. H. (1995) Solid-phase synthesis of peptide nucleic acids J. Pept. Sci. 3, 175-183
Mergny, J. L. and Lacroix, L. (2003) Analysis of thermal melting curves Oligonucleotides 13, 515-537 (Pubitemid 38296149)
Smargiasso, N., Rosu, F., Hsia, W., Colson, P., Baker, E. S., Bowers, M. T., De Pauw, E., and Gabelica, V. (2008) G-quadruplex DNA assemblies: Loop length, cation identity, and multimer formation J. Am. Chem. Soc. 130, 10208-10216
HyperChem 7.5; Hypercube, Inc.; Gainesville, FL, 2002.
Paramasivan, S., Rujan, I., and Bolton, P. H. (2007) Circular dichroism of quadruplex DNAs: Applications to structure, cation effects and ligand binding Methods 43, 324-331 (Pubitemid 47633205)
Gabelica, V., Baker, E. S., Teulade-Fichou, M. P., De Pauw, E., and Bowers, M. T. (2007) Stabilization and structure of telomeric and c-myc region intramolecular G-quadruplexes: The role of central cations and small planar ligands J. Am. Chem. Soc. 129, 895-904 (Pubitemid 46183939)
Ganesh, K. N. and Nielsen, P. E. (2000) Peptide nucleic acids: Analogs and derivatives Curr. Org. Chem. 4, 931-943
Kushon, S. A., Jordan, J. P., Seifert, J. L., Nielsen, H., and Armitage, B. A. (2001) Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins J. Am. Chem. Soc. 123, 10805-10813 (Pubitemid 33041991)
Amato, J., Oliviero, G., De Pauw, E., and Gabelica, V. (2009) Hybridization of short complementary PNAs to G-quadruplex forming oligonucleotides: An electrospray mass spectrometry study Biopolymers 91, 244-255
Kushon, S. A., Jordan, J. P., Seifert, J. L., Nielsen, H., Nielsen, P. E., and Armitage, B. A. (2001) Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins J. Am. Chem. Soc. 123, 10805-10813 (Pubitemid 33041991)
Datta, B. and Armitage, B. A. (2001) Hybridization of PNA to structured DNA targets: quadruplex invasion and the overhang effect J. Am. Chem. Soc. 123, 9612-9619 (Pubitemid 32937734)
Hardin, C. C., Perry, A. G., and White, K. (2000) Thermodynamic and kinetic characterization of the dissociation and assembly of quadruplex nucleic acids Biopolymers 56, 147-194 (Pubitemid 33115750)
Schultze, P., Hud, N. V., Smith, F. W., and Feigon, J. (1999) The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4)) Nucleic Acids Res. 27, 3018-3028 (Pubitemid 29355713)
Ray, A. and Nordén, B. (2000) Peptide nucleic acid (PNA): its medical and biotechnical applications and promise for the future FASEB J. 14 (9) 1041-1060 (Pubitemid 30350386)