Abstract :
[en] The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It
provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies.
Our results showed that (1) P1 P4 interact with the cKit87up
quadruplex, and (2) the binding mode depends on the quadruplex
stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in
NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid
complexes, thus acting as “quadruplex openers”.
Scopus citations®
without self-citations
27