Reference : Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Scientific journals : Article
Life sciences : Biochemistry, biophysics & molecular biology
Physical, chemical, mathematical & earth Sciences : Chemistry
Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Amato, Jussara [ > > ]
Pagano, Bruno [ > > ]
Borbone, Nicola [ > > ]
Oliviero, Giorgia [ > > ]
Gabelica, Valérie mailto [Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.) >]
De Pauw, Edwin mailto [Université de Liège - ULiège > Département de chimie (sciences) > GIGA-R : Laboratoire de spectrométrie de masse (L.S.M.) >]
D'Errico, Stefano [ > > ]
Piccialli, Vincenzo [ > > ]
Varra, Michela [ > > ]
Giancola, Concetta [ > > ]
Piccialli, Gennaro [ > > ]
Mayol, Luciano [ > > ]
Bioconjugate Chemistry
American Chemical Society
Yes (verified by ORBi)
[en] mass spectrometry ; G-quadruplex ; non-covalent ; DNA ; nucleic acids ; PNA
[en] The cKit87up sequence d(50AGGGAGGGCGCTGGGAGGAGGG30) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It
provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K+- or NH4+-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies.
Our results showed that (1) P1 P4 interact with the cKit87up
quadruplex, and (2) the binding mode depends on the quadruplex
stability. In Kþ buffer, P1-P4 bind the ckit87up quadruplex structure as “quadruplex-binding agents”. The same holds for P1 in
NH4þ solution. On the contrary, in NH4þ solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid
complexes, thus acting as “quadruplex openers”.
Giga-Systems Biology and Chemical Biology
Fonds de la Recherche Scientifique (Communauté française de Belgique) - F.R.S.-FNRS

File(s) associated to this reference

Fulltext file(s):

Restricted access
2011-BioconjChem_Jussara_ckit.pdfPublisher postprint3.95 MBRequest copy

Bookmark and Share SFX Query

All documents in ORBi are protected by a user license.